StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Human Genome Project. FGFR3: ACHONDROPLASIA - Dissertation Example

Cite this document
Summary
The molecular weight of the fibroblast growth factor was around 115- 150 kilo daloton and they have a specific binding capacity. (Kalff and Spencer 2012). There were 18 structurally related polypeptdies. This gene is present in the human chromosome 4p16.3 and there are 2520 kb in the open reading frame.(Vajo, Francomano and Wilkin 2000). …
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER99% of users find it useful
Human Genome Project. FGFR3: ACHONDROPLASIA
Read Text Preview

Extract of sample "Human Genome Project. FGFR3: ACHONDROPLASIA"

?Discussion: The result indicates the successful completion of the project. The FGFR3 gene was selected for the project and the knowledge regarding the gene was acquired. There are four main types of FGFRs. FGFR3 was found to act as a dimer for the proteins. The molecular weight of the fibroblast growth factor was around 115- 150 kilo daloton and they have a specific binding capacity. (Kalff and Spencer 2012). There were 18 structurally related polypeptdies. This gene is present in the human chromosome 4p16.3 and there are 2520 kb in the open reading frame. (Vajo, Francomano and Wilkin 2000). Human and mouse FGFR3 has the base pair length of 16.5 kb and 15 kb respectively. (Vajo, Francomano and Wilkin 2000). 18 introns and 19 exons are present in the gene. The initiation and termination of the translation sites were found in the 2nd and 19th exon respectively. (Vajo, Francomano and Wilkin 2000). The studies have found that the translational activity can be increased by a 20 to 40 fold for the alteration at the initiation part of the FGFR3 gene. (Parker et al. 2013). The proteins of FGFR3 are highly conserved. There are three immunoglobulin sites with the tyrosine kinase receptor rolling round. (Parker et al. 2013). FGFR3 activation requires the heparin binding domain. The binding affinity and tissue specific expression are encoded in the III b and III c exons. (Monsonego-Ornan 2000). The expression level varies in the rats and mouse. The expression level is the same at the infant level and at the developmental stage. FGFR3 is expressed well at the cell surface receptor. Defects in the gene cause many disorders like myeloma and carcinoma. At the embryogenesis, the expressions of the genes are very easy. (Parker et al. 2013). The receptor tyrosine kinase is commonly mutated in the bladder and at the cancer especially cervical cancer. The FGFR3 acts as affinity receptors for nine receptors. The variations of the protein level are high at the bone and essential for bone development. Cartilage rudiment is the important sign of dwarfism associated with Achondroplasia. (Evans 2007). The cells require a gradient complex of signaling phenomenon. The genes that code for the immunoglobulin are present at the exon 3. Variation in the codons at the FGFR3 results in the alteration of the structure and function. The mutations cause hydrochondroplasia in the patients. (Evans 2007). The phosphorylation and the rate of the disease are highly related to each other. The Fibroblast receptor family contributes the major signaling system in the cell, the fibroblast growth factors are found to contain similar homology among them. The structural motifs are the highly reserved structures. (Sherbet 2011).The targets of the cell processes are proliferation, differentiation, motility, growth, angiogenesis and cell metabolism. Single mutations at the FGFR3 gene were found to cause Achondroplasia. The mutation at the GLY 380 Arg , the transmembrane domain of the tyrosine kinase receptor, caused Achondroplasia in 90% of the patients. (Sherbet 2011). The design of the primers required the consideration of various parameters. The base composition and length of primer are particularly important characteristics in facilitation of amplification of specific PCR products. The GC content, secondary structure presence of poly- purine or poly – pyrimidine (adenine and guanine or cytosine and thymine) and the homology with the other parts of the DNA are important along with the influence of the primer design. (Zhang, Davidson and Cheng 2013). Some of the web programs such as Primer 3 significantly enhanced the stage with the parameters for the PCR to enable DNA amplification. The primers should be of length between 19 and 20 base pairs in length. As per the general thumb rule, the primers should be 18 – 30 nucleotides in length. (Chen and Janes 2004). The human genome length is 3 x 10 ^ 9 nucleotides in which we must identify the FGFR3 factor using the primers and other techniques. (Chen and Janes 2004). The results of the prier design also indicates that the primers possessed melting temperatures which had almost the similar temperatures with + or – 5 o C. (Chen and Janes 2004). Therefore all the primers were within 1oC with each other. If the difference between the annealing temperatures is greater than 1 oC, then the amplification of the given standard will favor the amplification of the one strand or the non-specific hybridization of one PCR primer. Hence non-specific hybridization is reduced by using the primers of same length and the annealing temperature almost equal. (Chen and Janes 2004). Similarly non specific hybridization can be detected using the smears and the presence of the multiple bands identified by the gel electrophoresis. Thus the design of the primers was successful. The explanation for the GC content of the primer was that GC content has a strong influence on the hybridization stability with the primers and the target DNA. The GC content should be between 50% - 55%. (Yuryev 2007).The GC content of the primers chosen was found to contain 50% and 55% respectively. Additionally the increased GC-content of the primer sequences increases the probability of long stretch of GC repeats. This leads to the formation of the internal hairpin loops and secondary structures to prevent the complete hybridization. (Yuryev 2007). In designing the primer sequences the internal complementary sequences should be avoided. The energy related to it is known as hairpin energy. If the value is lower, then the energy will be better. There is no contemporary region between added in the PCR reaction mix. (Tomlinson et al. 2007). Sometimes primer binds with another primer leads to the formation of hybridization. In the current study, the DNA was isolated from the sample and DNA was sent for sequencing with a concentration of 1000 microgram. (Etlik, et al. 2008). The DNA was amplified using the PCR thermocycler. About 10 µl of the DNA was used for the sequencing. The forward and reverse primers were chosen using the bioinformatics web based tools. Web based bioinformatics tools uses the overlapping sequences for the analysis of the forward and reverse primers. The primer was designed based on the results from the BLAST. The new primer designed for the FGFR3 gene segment contained 20 nucleotides. (Etlik, et al. 2008). The melting point of the forward and reverse primers should be similar and adjustable such that they can be used as such for the amplification of the required gene sources. The forward primer is AATAACAACAGCGGGAATCG and the reverse primer is TCTAACGAGCTGCCTTCCTC. Both the primers were found to have the approximate melting points of 60 and 59.7 o C. (Etlik, et al. 2008). In the amplification of the gene, the identification of the annealing temperature plays an important role. The primers must melt and anneal to the DNA at the specific temperatures. (Etlik, et al. 2008). For the determination of the annealing temperature, PCR was run and the product was electrophorized and viewed under the illuminator. The wells of the gel were filled with the amplified DNA at different temperatures. Annealing at 59 o C was recommended by SIGMA – ALDRICH and the same was confirmed in the PCR performed for the DNA amplification. At 59 o C, there was no DNA concentration indicating some error. Thus in the figure 1, the need for the modification of the DNA was understood. The DNA amplification (figure 2) was performed at different temperatures such as 59 o C, 62 o C and 64 o C. it was observed that at the temperature of 59 o C and 64 o C the DNA amplification was very less. Thin band were observed. The amplification at higher temperatures such as 62 o C, 64 o C and 66 o C was seen. The wells were loaded with the sample and were found that higher temperature produced no bands. (Etlik, et al. 2008). The working buffer was altered to ensure perfect solution provided by all. The amplified DNA was then performed using the proper dilution factor. The concentration of the DNA was 628.5µg/ml. The activating and inactivating pathways were performed by the FGFR. The results of DNA quantification indicates that the volume of the amplified DNA was 628.5µg/ml. the absorbance readings are far too low to be considered precise and accurate with all absorbencies less than 0.2 and 1.2. Significant alteration is required for this part of the protocol. For obtaining better results the volume of the amplified DNA must be used. Since, the mutations of the hypochondroplasia and Achondroplasia are identified in the FGFR3 only through sequencing. (L'Hote and Knowles 2005). The oligonucleotides required for primers are derived through literature or software programs design. (Brook, Clayton and Brown 2011). The consensus sequence obtained was subjected to the BLAST search and the single nucleotide polymorphisms were identified. The most important are the G-> A mutations in the exon 3. Only a single polymorphism was identified in the nucleotide position 380. The BLAST results have found that there are 88% similarities between the sequence of the gene and human chromosome. There were no gaps in both the sequences. The matching of the results is very high in the obtained sample such that 628.5µg/ml of the amplified and concentrated DNA was obtained. Similar results were obtained for the detection of the hypochondroplasia patients. The alignment of the forward and reverse primers has resulted in the consensus sequence of 395 nucleotides. This sequence is very less than that expected because some regions are not aligned and thus comparison was not disregarded from analysis. Single nucleotide polymorphism was found not to affect the gene FGFR3; the person is free from the manifestations. (Li, You and Hristova, 2006). The PCR was performed and the DNA was amplified using similar procedures and was found that the mutation at the lys650Glu of the distal kinase domain and single mutation of the proximal extracellular binding domain asn 540 lys were the major causes for the hypochondroplasia. (Horton 2006). Similarly the mutation effects of the thanotophoric dysplasia type I was identified to be caused by the achondroplasia. High- resolution melting (HRM) method was used to detect the mutations. HRM is the new rapid and reliable approach for the molecular detection of nucleotides. This technique provides early diagnosis and prevention of achondroplasia. (He, Xie and Ren 2012). Using restriction fragment length polymorphism and polymerase chain reaction, the molecular diagnosis for the FGFR3 mutations were carried over by Satiroglu-Tufan et al. (2006), and it was observed that the combination of the two technique provided greater accuracy of the results and the forward and reverse primer were designed with improved technique. (Satiroglu-Tufan et al. 2006). Since 97% of Achondroplasia are caused by one of the two mutations, (G1138A and G1138C) at the fibroblast growth factor receptor 3 gene, by the aminoacid substitution G380R. Three single base pair polymorphisms were identified in the case of Achondroplasia in the FGFR3 gene and they are always in close proximity to the mutation sites. (Wilkin et al. 1998). Single nucleotide polymorphisms such as rs7921, rs7956547, rs3761243, rs11737764, rs6599400, rs1690916 was carried out in people of different histological structure. (Knowles 2007). It was observed that the polymorphisms at rs6599400 and rs1690916 were detected to have greater disease risks. These polymorphisms are present in the untranslated regions of the 5’ end of the FGFR3. Thus the study concluded that in order to predict the disease condition, the formation of the association between the rs6599400 and rs1690916 must be studied and the tumor development and the risks associated with them are determined. (Naumov et al. 2012). Conclusion: All the aims of the project were accomplished. The physiological role and the effects of mutagenesis on the gene FGFR3 was studied and understood clearly. Thus the first aim was satisfied. The primers were selected for a region of the gene FGFR3 and the gene was amplified. Thus the second and third aims of the project were accomplished. The amplification of the DNA was the challenging part in this project. The DNA was amplified at the perfect time by the determination of the gene sequence and gene length. The annealing temperature of the gene is very important for the determination of the PCR product quality. Annealing temperature is the maximum temperature at which the DNA extraction from the sample is best. The annealing temperature was found to be 59 oC. Thus the third part of the project was accomplished. Using the bioinformatics software, the design of the forward and reverse primers was developed to have higher polymorphism with the FGFR3 exon 3. 88% similarity between the sequence obtained from the FGFR3 gene and the human genome indicates that there are good polymorphism between the identified sequence and the human genome. References: Brook, CGD., Clayton, P and Brown, R., 2011. Brook’s Clinical Pediatric Endocrinology, John Wiley and Sons. Chen, BY and Janes, HW., 2004. PCR Cloning Protocols, Springer. Etlik O, Koksal V, Tugba Arican-Baris S and Baris I., 2008. An improved tetra-primer PCR approach for the Detection of the FGFR3 G380R Mutation responsible for Achondroplasia, Molecular and Cellular probes, Vol.22 , No.2, pp. 71-5 Evans, SSV., 2007. Bioactive Conformation 1, Springer. He X, Xie F, Ren ZR., 2012, Rapid detection of G1138A and G1138C mutations of the FGFR3 gene in patients with Achondroplasia using high-resolution Melting Analysis, Vol. 16, No.4, pp. 297-301. Horton, WA., 2006. Molecular pathogenesis of Achondroplasia, Growth, Genetics and Hormones, Vol.22, No.4, pp. 49 – 63. Kalff, A and Spencer, A., 2012. The t(4;14) Translocation and FGFR3 overexpression in Multiple Myeloma: Prognostic implications and current Clinical Strategies, Blood Cancer Journal, Vol. 2, No. 9, pp. e89. Knowles, MA., 2007. Role of FGFR3 in Urothelial Cell Carcinoma: Biomarker and potential Therapeutic Target, World Journal of Urology, Vol. 25, No. 6, pp 581- 593. L'Hote, CGM and Knowles, MA., 2005. Cell responses to FGFR3 signalling: Growth, Differentiation and Apoptosis, Experimental Cell Research, Vol. 304, No. 2, pp. 417–431 Li, E., You, M and Hristova, K., 2006. FGFR3 Dimer Stabilization Due to a Single Amino Acid Pathogenic Mutation, Journal of Molecular Biology, Vol. 356, No. 3, pp. 600–612 Monsonego-Ornan, E., Adar, R., Feferman, T., Segev, O and Yayon, A., 2000. The Transmembrane Mutation G380R in Fibroblast Growth Factor Receptor 3 Uncouples Ligand-Mediated Receptor Activation from Down-Regulation. Molecular and Cellular Biology, Vol. 20, No. 2, pp. 516–522. Naumov, VA., Generozov, EV., Solovyov, YN., Aliev, MD and Kushlinsky, NE., 2012, Association of FGFR3 and MDM2 gene nucleotide polymorphisms with Bone Tumor, Bulletin of Experimental Biology and Medicine, Vol.153, No.6, pp. 869-73 Parker, BC., Annala, MJ., Cogdell, DE., Granberg, KJ., Sun, Y., Ji, P., Li, X., Gumin, J., Zheng, H., Hu, L., Yli-Harja, O., Haapasalo, H., Visakorpi, T., Liu, X., Liu, CG., Sawaya, R., Fuller, GN., Chen, K., Lang, FF., Nykter, M and Zhang W., 2009. The Tumorigenic FGFR3-TACC3 Gene Fusion escapes miR-99a Regulation in Glioblastoma, The Journal of Clinical Investigation, Vol. 123, No.2, pp. 855-65. Satiroglu-Tufan, NL., Tufan, AC., Semerci, CN. and Bagci, H., 2006. Accurate diagnosis of a Homozygous G1138A Mutation in the Fibroblast Growth Factor Receptor 3 gene Responsible for Achondroplasia, The Tohoku Journal of Experimental Medicine Vol. 208, No.2, pp.103-7. Sherbet, GV., 2011. Growth Factors and Their Receptors in Cell Differentiation, Cancer and Cancer Therapy, Elsevier. Tomlinson, DC., Baldo, O, Harnden, P and Knowles, MA., 2007. FGFR3 Protein expression and its Relationship to Mutation Status and Prognostic Variables in Bladder Cancer, The Journal of Pathology, Vol. 213, No. 1, pp. 91–98,Vajo, Z., Francomano, CA and Wilkin, DG., 2000. The Molecular and Genetic Basis of Fibroblast Growth Factor Receptor 3 Disorders: The Achondroplasia Family of Skeletal Dysplasias, Muenke Craniosynostosis, and Crouzon Syndrome with Acanthosis Nigricans, Endocrine Reviews, Vol. 21, No.1, pp. 23 - 39. Wilkin, DJ., Szabo, JK., Cameron, R., Henderson, S., Bellus, GA., Mack, ML., Kaitila, I., Loughlin, J., Munnich, A., Sykes, B., Bonaventure, J and Francomano, CA., 1998. Mutations in Fibroblast Growth-factor Receptor 3 in sporadic cases of Achondroplasia occur exclusively on the Paternally derived Chromosome, American Journal of Human genetics, Vol. 63, No. 3, pp. 711-6. Yuryev, A., 2007. PCR primer Design, Springer. Zhang, S., Davidson, DD and Cheng, L., 2013. Clinical Molecular Biology: Principles, Molecular Genetic Pathology, Springer New York. Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Human Genome Project. FGFR3: ACHONDROPLASIA Dissertation”, n.d.)
Human Genome Project. FGFR3: ACHONDROPLASIA Dissertation. Retrieved from https://studentshare.org/health-sciences-medicine/1474732-human-genome-project-fgfr3-achondroplasia
(Human Genome Project. FGFR3: ACHONDROPLASIA Dissertation)
Human Genome Project. FGFR3: ACHONDROPLASIA Dissertation. https://studentshare.org/health-sciences-medicine/1474732-human-genome-project-fgfr3-achondroplasia.
“Human Genome Project. FGFR3: ACHONDROPLASIA Dissertation”, n.d. https://studentshare.org/health-sciences-medicine/1474732-human-genome-project-fgfr3-achondroplasia.
  • Cited: 0 times

CHECK THESE SAMPLES OF Human Genome Project. FGFR3: ACHONDROPLASIA

Tyrosine kinase inhibitors as targeted agents for the treatment of cancer

Therapeutic advances have been made in the recent past whereby many patients who have had cancers have been able to lengthen the span of their lives through earlier detection and the support of combination therapies or targeted therapies which have evolved through research and clinical trials.... hellip; The appropriate therapejutic management of cancer has been evasive in spite of the expansive volume of research....
45 Pages (11250 words) Dissertation

Achondroplasia Dwarfism

hellip; achondroplasia Dwarfism Human body is made up of cells containing a substance that codes for protein type known as deoxyribonucleic acid (DNA), these DNA when wrapped together are known as chromosomes.... achondroplasia also known as ACH, Chondrodystrophia fetalis, Chondrodystrophy syndrome, Congenital osteosclerosis, Dwarf achondroplastic or Osteosclerosis congenital is the most common disproportionate form of dwarfism where converting the cartilage into bone (ossification) is affected....
3 Pages (750 words) Research Paper

The Human Genome Project

The human genome project represents one of the most important projects in the history of humanity.... he human genome project represents an effort to determine more than 3 billion nucleotides located within the human genome and to identify the genes that are present.... Ari Patrinos, who is the head of the Office of Biological and Environmental Research, led the human genome project that was initiated by the US Department of Energy.... At any given time, the human genome project funded about 200 separate principal investigators....
5 Pages (1250 words) Essay

Role of Genetic Variations in Human Diseases

hellip; All these led to the development and automatization of DNA sequencing leading to generation of physical and genetic maps by the well discussed human genome project (HGP).... n fact following the knowledge accumulation from the human genome project, the causation of common and complex diseases in relation to genetic variation in the fields of molecular epidemiology, medicine, and pharmacogenomics was a prime research interest.... However, in reality, the post human genome project research in this field is tending to increasingly demonstrate that virtually every medical condition has a genetic component....
16 Pages (4000 words) Research Paper

The Human Genome Project

The human genome project (HGP) is one of the most important projects in the history of mankind which will provide considerable benefits to entire humanity as the sequencing of human genomes will generate break through advances in the field of medicine.... Thus the HGP is a sponsored program of the Department of Energy and National Institutes of Health Genome Programs as a national effort which planned to categorize all human genetic information by totally identifying the sequence of the DNA in the human genome....
8 Pages (2000 words) Essay

The Human Genome Project

This paper “The human genome project” will describe how the sequence of the human genome was determined, and try to answer this important question, has the human genome project lived up to expectations?... The human genome project began in 1990.... The human genome project began in 1990, with the aim of establishing the DNA sequence of the whole euchromatic human genome in a period of 15 years .... Nonetheless, the great success of the project is clear, the completion of human genome project brought a new age in medicine and also resulted in major advancements in the forms of technology applied in sequence DNA ....
14 Pages (3500 words) Essay

Role of Genetic Variations in Human Diseases: Past, Present, Future

This paper explores the development and automatization of DNA sequencing leading to a generation of physical and genetic maps by the well-discussed human genome project (HGP).... In fact following the knowledge accumulation from the human genome project, the causation of common and complex diseases in relation to genetic variation in the fields of molecular epidemiology, medicine, and pharmacogenomics was a prime research interest.... However, in reality, the post-human genome project research in this field is tending to increasingly demonstrate that virtually every medical condition has a genetic component....
16 Pages (4000 words) Research Paper

The Human Genome Project

This report "The human genome project" focuses on the collaborative and international research project, whose mission was the complete understanding and mapping of the genes present in the human body.... nbsp;… The main focus of this project was the DNA sequence of an individual.... The next step of this project involved analyzing the genome sequence from different populations.... This project was also compared with the Apollo program whose purpose was to bring mortality to the moon....
8 Pages (2000 words) Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us